Question 1
How many solutions are possible for a string reconstruction problem with 12 words?

The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term: 21 questions for 50 marks in 120 minutes. Every question is below with its answer. Take it as a timed mock test to be marked, or read it through first.
How many solutions are possible for a string reconstruction problem with 12 words?
Correct answer
What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?
20
22
15
21
Correct answer
22
What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?
4.1
2.4
3.4
2
Correct answer
2
What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCTAAATATCAAG”?
15
14
16
17
Correct answer
15
In a directed protein-protein interaction network, the researchers want to identify protein clusters that interact densely with each other but have sparse connections to other proteins in the network. Which method would be the most effective in discovering these hubs?
Using betweenness centrality.
Using the degree distribution.
Using Girvan-Newman algorithm.
Finding nodes with high in-degree but low out-degree.
Correct answer
Using Girvan-Newman algorithm.
Which of the following statements is true regarding motif identification in networks?
Motifs are patterns found in random networks
Motifs are exclusively found in biological networks and are absent in other types of networks.
Motif identification involves detecting recurring and significant subgraph patterns in a network.
Motifs are only relevant in small networks and have no significance in larger- scale networks.
Correct answer
Motif identification involves detecting recurring and significant subgraph patterns in a network.
Consider the gene interaction networks given below for 4 different conditions (2 normal and 2 diseased).
Which of the following can be observed from the networks shown?
A-E is a housekeeping interaction
E-B is a housekeeping interaction
A-D is a differential interaction between normal and disease networks
E-D is a differential interaction between normal and disease networks
Correct answer
A-D is a differential interaction between normal and disease networks
Investigator X is tasked with identifying the spread of a virus in a city. The team has narrowed down the origin of the spread to 4 locations and obtained the contact tracing information for 4 suspected individuals. The social contact network is represented as a bipartite graph. Answer the following questions based on the provided network.
Find the projection of the location contact network at 11:00. Note: No transition time is considered for traveling between locations.
Correct answer
Match the following disease spread problems with their solution; is a people graph, is a location graph.
Problem:
(i) Maximum people at risk for a disease originating from a single infected person?
(ii) Key locations to impose lockdown?
(iii) Contact tracing of the infected person?
Solution:
(A) Connected components in that include node corresponding to the infected person
(B) Nodes with the highest centrality in
(C) Size of the largest connected component in
(i)-A, (ii) - B, (iii) -C
(i)-B, (ii) - A, (iii) -C
(i)-C, (ii) - A, (iii) -B
(i)-C, (ii) - B, (iii) -A
Correct answer
(i)-C, (ii) - B, (iii) -A
What is the total number of nodes of the De-Bruijn Graph generated from the 2-mers obtained from “TACTCTAAG”?
3
5
6
4
Correct answer
4
Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1”, find the final score for the best global alignment between the two sequences.
10
11
2
8
Correct answer
11
Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruct the sequence from which the k-mers were generated.
CTATACCGTAGGCG
CTATGCCGTAGGCG
ATCGGTACAACGG
TATGCCGTAGGCGC
Correct answer
CTATGCCGTAGGCG
We have a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score greater than a threshold value, we assign an edge between the two in the graph. Given this, which of the following is true:
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete graph
There will be two connected components in the resultant graph
Correct answers
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete graph
Which of the following makes an appropriate pair?
Node classification – Predicting drug-drug interaction
Graph classification – Predicting toxicity of a chemical compound
Link Prediction – Predicting function of novel proteins
Graph regression – Predicting free energy of hydration
Correct answers
Graph classification – Predicting toxicity of a chemical compound
Graph regression – Predicting free energy of hydration
Which of these are challenges one might encounter in the process of genome assembly?
Erroneous reads
Large volumes of data
Duplicate sequences
Incomplete graph
Correct answers
Erroneous reads
Large volumes of data
Duplicate sequences
Consider the following two statements:
Statement 1: Reads from the genome sequencing are prone to error.
Statement 2: Sequence alignment can be used to overcome this problem.
Based on your observations, which of the following statements is not true?
Both statements are true and statement 2 is a potential solution for statement 1
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
Correct answers
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
Correct answers
Correct answers
Use the following metabolic network to answer the given questions.
What is the dimension of the stoichiometric matrix of the provided network?
4×4
5×5
4×5
5×4
Correct answer
4×5
Use the following metabolic network to answer the given questions.
R1 - R2
b1 + b2 - R2
b1 + b2 - b3
R2 - R1
Correct answer
R1 - R2
Use the following metabolic network to answer the given questions.
What is the stoichiometric matrix of the provided network? Note: The order of reactions is (R1, R2, b1, b2, b3)
Correct answer