uiz Space

January 2024 term · Big Data and Biological Networks · BSBT4002

Big Data and Biological Networks Quiz 2: 24 March 2024 (January 2024 term)

The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term: 21 questions for 50 marks in 120 minutes. Every question is below with its answer. Take it as a timed mock test to be marked, or read it through first.

Questions
21
Marks
50
Duration
120 min
MCQ
15
MSQ
6

Updated

Official paper: IIT M DEGREE AN EXAM QDB2 24 Mar 2024 · No negative marking.

Question 1

+1 markOne correct option

How many solutions are possible for a string reconstruction problem with 12 words?

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answer

  • D

Question 2

+1 markOne correct option

What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?

  1. A

    20

  2. B

    22

  3. C

    15

  4. D

    21

Show answer

Correct answer

  • B

    22

Question 3

+2 marksOne correct option

What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?

  1. A

    4.1

  2. B

    2.4

  3. C

    3.4

  4. D

    2

Show answer

Correct answer

  • D

    2

Question 4

+2 marksOne correct option

What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCTAAATATCAAG”?

  1. A

    15

  2. B

    14

  3. C

    16

  4. D

    17

Show answer

Correct answer

  • A

    15

Question 5

+2 marksOne correct option

In a directed protein-protein interaction network, the researchers want to identify protein clusters that interact densely with each other but have sparse connections to other proteins in the network. Which method would be the most effective in discovering these hubs?

  1. A

    Using betweenness centrality.

  2. B

    Using the degree distribution.

  3. C

    Using Girvan-Newman algorithm.

  4. D

    Finding nodes with high in-degree but low out-degree.

Show answer

Correct answer

  • C

    Using Girvan-Newman algorithm.

Question 6

+2 marksOne correct option

Which of the following statements is true regarding motif identification in networks?

  1. A

    Motifs are patterns found in random networks

  2. B

    Motifs are exclusively found in biological networks and are absent in other types of networks.

  3. C

    Motif identification involves detecting recurring and significant subgraph patterns in a network.

  4. D

    Motifs are only relevant in small networks and have no significance in larger- scale networks.

Show answer

Correct answer

  • C

    Motif identification involves detecting recurring and significant subgraph patterns in a network.

Question 7

+2 marksOne correct option

Consider the gene interaction networks given below for 4 different conditions (2 normal and 2 diseased).

Which of the following can be observed from the networks shown?

  1. A

    A-E is a housekeeping interaction

  2. B

    E-B is a housekeeping interaction

  3. C

    A-D is a differential interaction between normal and disease networks

  4. D

    E-D is a differential interaction between normal and disease networks

Show answer

Correct answer

  • C

    A-D is a differential interaction between normal and disease networks

Question 8

+2 marksOne correct option

Investigator X is tasked with identifying the spread of a virus in a city. The team has narrowed down the origin of the spread to 4 locations and obtained the contact tracing information for 4 suspected individuals. The social contact network is represented as a bipartite graph. Answer the following questions based on the provided network.

Find the projection of the location contact network at 11:00. Note: No transition time is considered for traveling between locations.

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answer

  • B

Question 9

+2 marksOne correct option

Match the following disease spread problems with their solution; GPG_P is a people graph, GLG_L is a location graph.

Problem:

(i) Maximum people at risk for a disease originating from a single infected person?
(ii) Key locations to impose lockdown?
(iii) Contact tracing of the infected person?

Solution:

(A) Connected components in GPG_P that include node corresponding to the infected person
(B) Nodes with the highest centrality in G^L\hat{G}_L
(C) Size of the largest connected component in GPG_P

  1. A

    (i)-A, (ii) - B, (iii) -C

  2. B

    (i)-B, (ii) - A, (iii) -C

  3. C

    (i)-C, (ii) - A, (iii) -B

  4. D

    (i)-C, (ii) - B, (iii) -A

Show answer

Correct answer

  • D

    (i)-C, (ii) - B, (iii) -A

Question 10

+3 marksOne correct option

What is the total number of nodes of the De-Bruijn Graph generated from the 2-mers obtained from “TACTCTAAG”?

  1. A

    3

  2. B

    5

  3. C

    6

  4. D

    4

Show answer

Correct answer

  • D

    4

Question 11

+3 marksOne correct option

Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1”, find the final score for the best global alignment between the two sequences.

  1. A

    10

  2. B

    11

  3. C

    2

  4. D

    8

Show answer

Correct answer

  • B

    11

Question 12

+3 marksOne correct option

Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruct the sequence from which the k-mers were generated.

  1. A

    CTATACCGTAGGCG

  2. B

    CTATGCCGTAGGCG

  3. C

    ATCGGTACAACGG

  4. D

    TATGCCGTAGGCGC

Show answer

Correct answer

  • B

    CTATGCCGTAGGCG

Question 13

+2 marksOne or more correct options

We have a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score greater than a threshold value, we assign an edge between the two in the graph. Given this, which of the following is true:

Select all that apply.

  1. A

    Inserting a new node to the graph requires n comparisons

  2. B

    Inserting a new node is a node level task

  3. C

    If all the alignments have the same score, the resultant graph is a complete graph

  4. D

    There will be two connected components in the resultant graph

Show answer

Correct answers

  • A

    Inserting a new node to the graph requires n comparisons

  • B

    Inserting a new node is a node level task

  • C

    If all the alignments have the same score, the resultant graph is a complete graph

Question 14

+2 marksOne or more correct options

Which of the following makes an appropriate pair?

Select all that apply.

  1. A

    Node classification – Predicting drug-drug interaction

  2. B

    Graph classification – Predicting toxicity of a chemical compound

  3. C

    Link Prediction – Predicting function of novel proteins

  4. D

    Graph regression – Predicting free energy of hydration

Show answer

Correct answers

  • B

    Graph classification – Predicting toxicity of a chemical compound

  • D

    Graph regression – Predicting free energy of hydration

Question 15

+3 marksOne or more correct options

Which of these are challenges one might encounter in the process of genome assembly?

Select all that apply.

  1. A

    Erroneous reads

  2. B

    Large volumes of data

  3. C

    Duplicate sequences

  4. D

    Incomplete graph

Show answer

Correct answers

  • A

    Erroneous reads

  • B

    Large volumes of data

  • C

    Duplicate sequences

Question 16

+3 marksOne or more correct options

Consider the following two statements:
Statement 1: Reads from the genome sequencing are prone to error.
Statement 2: Sequence alignment can be used to overcome this problem.
Based on your observations, which of the following statements is not true?

Select all that apply.

  1. A

    Both statements are true and statement 2 is a potential solution for statement 1

  2. B

    Both statements are true but statement 2 is not a solution to statement 1

  3. C

    Both statements are false

  4. D

    Statement 1 is false but Statement 2 is true

Show answer

Correct answers

  • B

    Both statements are true but statement 2 is not a solution to statement 1

  • C

    Both statements are false

  • D

    Statement 1 is false but Statement 2 is true

Question 17

+3 marksOne or more correct options

Select all that apply.

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answers

  • B
  • C

Question 18

+3 marksOne or more correct options

Select all that apply.

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answers

  • B
  • C
  • D

Question 19

+3 marksOne correct option

Use the following metabolic network to answer the given questions.

What is the dimension of the stoichiometric matrix of the provided network?

  1. A

    4×4

  2. B

    5×5

  3. C

    4×5

  4. D

    5×4

Show answer

Correct answer

  • C

    4×5

Question 20

+3 marksOne correct option

Use the following metabolic network to answer the given questions.

  1. A

    R1 - R2

  2. B

    b1 + b2 - R2

  3. C

    b1 + b2 - b3

  4. D

    R2 - R1

Show answer

Correct answer

  • A

    R1 - R2

Question 21

+3 marksOne correct option

Use the following metabolic network to answer the given questions.

What is the stoichiometric matrix of the provided network? Note: The order of reactions is (R1, R2, b1, b2, b3)

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answer

  • C