Question 1
How many solutions are possible for a string reconstruction problem with 12 words?
How many solutions are possible for a string reconstruction problem with 12 words?
What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?
20
22
15
21
What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?
4.1
2.4
3.4
2
Sign in with Google — it is free — to see every question with its answer and explanation, practise it in learning mode, or take it as a timed mock test.
The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term: 21 questions for 50 marks in 120 minutes. The first 3 questions are below. Sign in with Google — it is free — to see the whole paper with its answers and explanations, in learning mode or as a timed mock test.
| Feature | Big Data and Biological Networks Quiz 2 24 Mar 2024 at a glance |
|---|---|
| Term | January 2024 term |
| Subject | Big Data and Biological Networks |
| Course code | BSBT4002 |
| Questions | 21 |
| Marks | 50 |
| Duration | 120 min |
| MCQ | 15 |
| MSQ | 6 |
| Official paper | IIT M DEGREE AN EXAM QDB2 24 Mar 2024 |
| Negative marking | No negative marking. |
| Updated |