Quiz Space

Big Data and Biological Networks Quiz 2: 24 March 2024 (January 2024 term)

Question 1

+1 markOne correct option

How many solutions are possible for a string reconstruction problem with 12 words?

  1. A
  2. B
  3. C
  4. D

Question 2

+1 markOne correct option

What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?

  1. A

    20

  2. B

    22

  3. C

    15

  4. D

    21

Question 3

+2 marksOne correct option

What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?

  1. A

    4.1

  2. B

    2.4

  3. C

    3.4

  4. D

    2

18 more questions in this paper

Sign in with Google — it is free — to see every question with its answer and explanation, practise it in learning mode, or take it as a timed mock test.

More on the Big Data and Biological Networks Quiz 2 24 Mar 2024 paper

The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term: 21 questions for 50 marks in 120 minutes. The first 3 questions are below. Sign in with Google — it is free — to see the whole paper with its answers and explanations, in learning mode or as a timed mock test.

FeatureBig Data and Biological Networks Quiz 2 24 Mar 2024 at a glance
TermJanuary 2024 term
SubjectBig Data and Biological Networks
Course codeBSBT4002
Questions21
Marks50
Duration120 min
MCQ15
MSQ6
Official paperIIT M DEGREE AN EXAM QDB2 24 Mar 2024
Negative markingNo negative marking.
Updated

Same Quiz 2, other subjects

More Big Data and Biological Networks