uiz Space

January 2023 term · Big Data and Biological Networks · BSBT4002

Big Data and Biological Networks Quiz 2: 2 April 2023, Set QPE2 (January 2023 term)

The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 2 Apr 2023, in the January 2023 term, set QPE2: 21 questions for 43 marks in 120 minutes. Every question is below with its answer. Take it as a timed mock test to be marked, or read it through first.

Questions
21
Marks
43
Duration
120 min
MCQ
15
MSQ
3
Written
3
Take as mock testPractise with answers

Updated

Official paper: IIT M DEGREE AN3 EXAM QPE3 02 Apr 2023 · No negative marking.

Question 1

+1 markOne correct option

Consider a network with n = 11 and m = 54. The number of triangular sub-graphs in the given network is

  1. A

    165

  2. B

    156

  3. C

    155

  4. D

    164

Show answer

Correct answer

  • B

    156

Question 1 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 2

+1 markOne correct option
  1. A

    a

  2. B

    b

  3. C

    c

  4. D

    d

Show answer

Correct answer

  • C

    c

Question 2 on its own page

Question 3

+1 markOne correct option

Modularity of a complete graph, given that all the nodes belong to a single community is

  1. A

    1

  2. B

    0.5

  3. C

    0

  4. D

    -1

Show answer

Correct answer

  • C

    0

Question 3 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 4

+1 markOne correct option

Which of the following cannot be a node in signalling network?

  1. A

    Ligand

  2. B

    Receptor

  3. C

    Transcription factor

  4. D

    DNA

Show answer

Correct answer

  • D

    DNA

Question 4 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 5

+1 markOne correct option

What is the number of 5-mers generated from the sequence “AGATATATTATTGTCTGTCA”?

  1. A

    3

  2. B

    14

  3. C

    16

  4. D

    10

Show answer

Correct answer

  • C

    16

Question 5 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 6

+1 markOne correct option

For two identical sequences of length n, which of the following is true

  1. A

    The similarity score is 2 × match_score. Where match_score is the score given toa match

  2. B

    The similarity score is matchscore + n . Where match_score is the score given toa match

  3. C

    The global alignment is the same as the local alignment

  4. D

    There can be gaps in the best alignment

Show answer

Correct answer

  • C

    The global alignment is the same as the local alignment

Question 6 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 7

+2 marksOne correct option

Ms.AAA wants to identify in which of the three networks given below, the bi-fan subgraph is a motif. For that, Ms. AAA generated hundreds of random graphs keeping the number of nodes, edges and node degrees the same. The distribution of number of bi-fan subgraphs present in the random networks is shown below in blue color and the vertical red line indicate the respective network’s subgraph count. Based on your assessment of the distributions below, in which graph(s) is the bi-fan subgraph a motif?

Ms.AAA wants to identify in which of the three networks given below, the bi-fan subgraph is a motif. For that, Ms. AAA generated hundreds of random graphs keeping the number of nodes, edges and node degrees the same. The distribution of number of bi-fan subgraphs present in the random networks is shown below in blue color and the vertical red line indicate the respective network’s subgraph count. Based on your assessment of the distributions below, in which graph(s) is the bi-fan subgraph a motif?

  1. A

    Graph - A

  2. B

    Graph - B

  3. C

    Graph - C

  4. D

    All of these

Show answer

Correct answer

  • C

    Graph - C

Question 7 on its own page

Question 8

+2 marksOne correct option

Which of the following are true about community detection in networks?

  1. A

    In a given community, nodes with higher degree would be less in the case ofpower-law networks

  2. B

    Given equal number of edges and nodes, the modularity is almost similar for apower-law network and Erdos-Renyi network

  3. C

    Girvan Newman algorithm can only predict two clusters in a network

  4. D

    Nodes grouped based on node-type in a bipartite graph has the highestmodularity

Show answer

Correct answer

  • A

    In a given community, nodes with higher degree would be less in the case ofpower-law networks

Question 8 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 9

+2 marksOne correct option

What is the average degree (regardless of the direction) of the 2-mer overlap graph constructed from “ATGACT”?

  1. A

    4.1

  2. B

    2.4

  3. C

    3.4

  4. D

    2

Show answer

Correct answer

  • B

    2.4

Question 9 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 10

+2 marksOne correct option

What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCT”?

  1. A

    5

  2. B

    4

  3. C

    6

  4. D

    7

Show answer

Correct answer

  • A

    5

Question 10 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 11

+2 marksOne correct option

What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCT”?

  1. A

    3

  2. B

    5

  3. C

    6

  4. D

    4

Show answer

Correct answer

  • B

    5

Question 11 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 12

+2 marksOne or more correct options

Use phylogenetic profiles method to identify the edges in the protein-protein interaction network

Use phylogenetic profiles method to identify the edges in the protein-protein interaction network

Select all that apply.

  1. A

    B-D

  2. B

    A-B

  3. C

    E-D

  4. D

    C-F

Show answer

Correct answers

  • B

    A-B

  • C

    E-D

Question 12 on its own page

Question 13

+2 marksOne or more correct options

We have a graph constructed by comparing n DNA sequences. If the two sequences can be aligned with a final score greater than a threshold, there exists an edge between the two in the graph. Given this, which of the following is true?

Select all that apply.

  1. A

    Inserting a new node to the graph requires n comparisons

  2. B

    Inserting a new node is a node level task

  3. C

    If all the alignments have the same score, the resultant graph is a completegraph

  4. D

    There will be two connected components in the resultant graph

Show answer

Correct answers

  • A

    Inserting a new node to the graph requires n comparisons

  • B

    Inserting a new node is a node level task

  • C

    If all the alignments have the same score, the resultant graph is a completegraph

Question 13 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 14

+2 marksOne or more correct options

Which of the following makes an appropriate pair?

Select all that apply.

  1. A

    Node classification – Predicting drug-drug interactions

  2. B

    Graph classification – Predicting toxicity of a chemical compound

  3. C

    Link Prediction – Predicting function of novel proteins

  4. D

    Graph regression – Predicting free energy of hydration

Show answer

Correct answers

  • B

    Graph classification – Predicting toxicity of a chemical compound

  • D

    Graph regression – Predicting free energy of hydration

Question 14 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 15

+3 marksOne correct option

Consider the below given gene interaction networks for 4 conditions (2 normal and 2 diseased). The housekeeping (HI) and the disease (DI) specific interactions of the given networks are

Consider the below given gene interaction networks for 4 conditions (2 normal and 2 diseased). The housekeeping (HI) and the disease (DI) specific interactions of the given networks are

  1. A

    HI: E-D, D-C, A-C; DI: A-E, A-D, E-B, E-C, B-D

  2. B

    HI: E-D, D-C, A-C; DI: A-E, A-D, E-B

  3. C

    HI: E-D, D-C; DI: A-E, A-D, E-B

  4. D

    HI: E-D, D-C, A-C; DI: E-C, B-D

Show answer

Correct answer

  • A

    HI: E-D, D-C, A-C; DI: A-E, A-D, E-B, E-C, B-D

Question 15 on its own page

Question 16

+3 marksOne correct option

The modularity of the given below network with nodes grouped based on the color is

The modularity of the given below network with nodes grouped based on the color is

  1. A

    -0.0556

  2. B

    0.389

  3. C

    0.5

  4. D

    -0.08

Show answer

Correct answer

  • A

    -0.0556

Question 16 on its own page

Question 17

+3 marksOne correct option

Given the two sequences “AGAGCTTA”, “AAGGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1”, find the final score for the best global alignment between the two sequences.

  1. A

    10

  2. B

    5

  3. C

    2

  4. D

    -8

Show answer

Correct answer

  • B

    5

Question 17 on its own pageAlso asked in Quiz 2 2 Apr 2023

Question 18

+3 marksOne correct option
  1. A

    ATCGGTACAACTCT

  2. B

    CAAATGGATCATAAA

  3. C

    ATCGGTACAACGG

  4. D

    TCTCAACATGGCTA

Show answer

Correct answer

  • A

    ATCGGTACAACTCT

Question 18 on its own page

Question 19

+3 marksWritten answer

Outline a strategy for generating a power law network with gamma = 2.4.
NOTE: Your answer should not exceed 150 words

Show answer

A written answer, not marked automatically.

Question 19 on its own page

Question 20

+3 marksWritten answer

List some challenges that are we encounter in the process of genome assembly.
NOTE: Your answer should not exceed 150 words

Show answer

A written answer, not marked automatically.

Question 20 on its own page

Question 21

+3 marksWritten answer

Explain how we can utilize sequence alignment in the problem of genome assembly.
NOTE: Your answer should not exceed 150 words

Show answer

A written answer, not marked automatically.

Question 21 on its own page