Quiz Space

Big Data and Biological Networks · Quiz 2 · 2 Apr 2023 · January 2023 term · Set QPE2

Big Data and Biological Networks Quiz 2 2 Apr 2023 — Question 18

Question 18

+3 marksOne correct option
  1. A

    ATCGGTACAACTCT

  2. B

    CAAATGGATCATAAA

  3. C

    ATCGGTACAACGG

  4. D

    TCTCAACATGGCTA

Show answer

Correct answer

  • A

    ATCGGTACAACTCT

Question 18 of 21 in the IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 2 Apr 2023, in the January 2023 term (IIT M DEGREE AN3 EXAM QPE3 02 Apr 2023). It carries 3 marks.

More questions from this paper

  1. Q1Consider a network with n = 11 and m = 54. The number of triangular sub-graphs in the given network is
  2. Q2Figure question
  3. Q3Modularity of a complete graph, given that all the nodes belong to a single community is
  4. Q4Which of the following cannot be a node in signalling network?
  5. Q5What is the number of 5-mers generated from the sequence “AGATATATTATTGTCTGTCA”?
  6. Q6For two identical sequences of length n, which of the following is true
  7. Q7Ms.AAA wants to identify in which of the three networks given below, the bi-fan subgraph is a motif. For that, Ms. AAA …
  8. Q8Which of the following are true about community detection in networks?
  9. Q9What is the average degree (regardless of the direction) of the 2-mer overlap graph constructed from “ATGACT”?
  10. Q10What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCT”?
  11. Q11What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCT”?
  12. Q12Use phylogenetic profiles method to identify the edges in the protein-protein interaction network Use phylogenetic prof…
  13. Q13We have a graph constructed by comparing n DNA sequences. If the two sequences can be aligned with a final score greate…
  14. Q14Which of the following makes an appropriate pair?
  15. Q15Consider the below given gene interaction networks for 4 conditions (2 normal and 2 diseased). The housekeeping (HI) an…
  16. Q16The modularity of the given below network with nodes grouped based on the color is The modularity of the given below ne…
  17. Q17Given the two sequences “AGAGCTTA”, “AAGGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1”…
  18. Q19Outline a strategy for generating a power law network with gamma = 2.4.\ NOTE: Your answer should not exceed 150 words
  19. Q20List some challenges that are we encounter in the process of genome assembly.\ NOTE: Your answer should not exceed 150 …
  20. Q21Explain how we can utilize sequence alignment in the problem of genome assembly.\ NOTE: Your answer should not exceed 1…