Opening the paper…

Big Data and Biological Networks, Quiz 2

January 2024 term, 24 Mar 2024, Set QDB2

Learning mode

Question 1

+1−0Single correct

How many solutions are possible for a string reconstruction problem with 12 words?

Select one option

A.
B.
C.
D.

Report a problem

to report a problem with this question.

Choose a question

Answered: 0
Not answered: 1
Marked for review: 0
Answered & marked for review: 0
Not visited: 20

Discussion

Submit this paper?

You cannot change your answers after submitting.

Answered: 0
Not answered: 1
Marked for review: 0
Answered & marked for review: 0
Not visited: 2

Instructions

The palette shows the status of every question. Pick a number to go straight to it.

Answered: 0
Not answered: 1
Marked for review: 0
Answered & marked for review: 0
Not visited: 2

Save & Next moves to the next question. Answers are saved as you go.
Mark for Review & Next flags the question to come back to. A flagged answer still counts.
Clear Response removes your answer to the question on screen.
The ← and → keys move to the previous and next question.

How many solutions are possible for a string reconstruction problem with 12 words? What is the number of 4-mers generated from the sequence :\ “AGATATATTATTGTCTTTTTTGTCA”? What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?