The IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 16 Mar 2025, in the January 2025 term: 22 questions for 50 marks in 120 minutes. Every question is below with its answer. Take it as a timed mock test to be marked, or read it through first.
What happens to scale-free networks when subjected to random node removal?
The network disintegrates rapidly
The diameter and characteristic path length decrease significantly
The network remains largely insensitive to the perturbation
The diameter and characteristic path length increase significantly
Correct answer
The network remains largely insensitive to the perturbation
Consider a regular lattice with n = 7 and m = 14. The number of triangular sub-graphs in the given network is
70
35
140
360
Correct answer
35
Consider the following set of metabolic reactions:
R1: P + Q → 2R
R2: 2Q + S → T
R3: R + T → 3U
R4: P + U → V + S
What is the density of the undirected substrate graph formed?
0.33
0.56
0.27
0.73
Correct answer
0.33
If a metabolite with high betweenness centrality is knocked out, what is the likely consequence?
Pathway redundancy increases, paradoxically making the metabolic network more resilient.
The network always compensates through alternative routes, ensuring no functional loss.
Metabolic pathways may become fragmented, potentially disrupting essential biochemical functions.
Only directly connected reactions are affected, while the overall network remains stable.
Correct answer
Metabolic pathways may become fragmented, potentially disrupting essential biochemical functions.
What is the average degree (regardless of the direction) of the 3-mer De-Bruijn graph constructed from “TCAGAGGT”?
4.1
2.4
3.4
2
Correct answer
2
What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATCGGTACAACTCTCTCATGCG”?
15
14
19
17
Correct answer
19
A researcher is studying network motifs in a biological network and generates randomized networks for comparison. Which of the following statements are correct regarding the randomization process?
Randomized networks must ideally retain the same number of nodes and edges as the original network.
Randomized networks can have a different degree distribution to ensure statistical significance.
Randomized networks can be generated using the configuration model, to ensure that the degree sequence of the original network is preserved.
Randomized networks can be generated by randomly adding new nodes and edges.
Correct answers
Randomized networks must ideally retain the same number of nodes and edges as the original network.
Randomized networks can be generated using the configuration model, to ensure that the degree sequence of the original network is preserved.
The Girvan–Newman algorithm for community detection involves which of the following steps?
Remove edges with the highest betweenness first.
Re-compute the betweenness after each edge removal.
Remove edges with the lowest betweenness first.
Remove nodes with the lowest betweenness first.
Correct answers
Remove edges with the highest betweenness first.
Re-compute the betweenness after each edge removal.
A researcher is modeling the spread of an infectious disease on a small-world network. Which of the following are true in the context of the likelihood of a disease outbreak?
The diameter of the network is an important factor, as it influences how quickly the disease can reach distant nodes.
The clustering coefficient is one of the parameters that determine the likelihood of localized outbreaks.
The degree distribution has no impact on disease spread in small-world networks.
The transmissibility of the disease is independent of the network structure.
Correct answers
The diameter of the network is an important factor, as it influences how quickly the disease can reach distant nodes.
The clustering coefficient is one of the parameters that determine the likelihood of localized outbreaks.
Which of these are challenges one might encounter in the process of genome assembly?
Erroneous reads
Large volumes of data
Duplicate sequences
Incomplete graph
Correct answers
Erroneous reads
Large volumes of data
Duplicate sequences
Consider the following two statements:
a. Statement 1: Reads from the genome sequencing are prone to error.
b. Statement 2: Sequence alignment can be used to overcome this problem.
Based on your observations, which of the following statements is not true?
Both statements are true and statement 2 is a potential solution for statement 1
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
Correct answers
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
Microbe ‘M’ has 50 reactions that are stuck when grown by itself. When ‘M’ is grown with ‘N’, the stuck reactions reduce to 40. When ‘M’ is paired with ‘O’, the number drops to 42. Which of the following statements hold true?
MSI of ‘M’ in the presence of ‘N’ is 0.2.
MSI of ‘M’ in the presence of ‘O’ is 0.16.
MSI of ‘M’ in the presence of ‘N’ and ‘O’ is 0.36.
MSI of ‘N’ in the presence of ‘M’ is 0.2.
Correct answers
MSI of ‘M’ in the presence of ‘N’ is 0.2.
MSI of ‘M’ in the presence of ‘O’ is 0.16.
Gene 1 → Gene 2
Gene 1 → Gene 3
Gene 3 → Gene 2
Gene 3 → Gene 1
Correct answers
Gene 1 → Gene 2
Gene 1 → Gene 3
How are network motifs related to the organization of gene regulatory networks?
They represent common patterns of gene regulation that appear frequently in the network
They can be interconnected to form modules, which can regulate specific gene sets
They are not relevant at all levels of regulatory networks
They are always independent of the modules in the network
Correct answers
They represent common patterns of gene regulation that appear frequently in the network
They can be interconnected to form modules, which can regulate specific gene sets
Which of the following are true about feed-forward loop (FFL) motifs in transcriptional regulatory networks?
FFLs are simple sequences of gene interactions with no regulation involved.
FFLs can involve both positive and negative regulation, which helps control gene expression in a dynamic manner.
FFLs are mainly found in eukaryotic organisms and are not present in prokaryotes.
In an FFL, feedback can either increase (amplify) or decrease (attenuate) the gene expression signal.
Correct answers
FFLs can involve both positive and negative regulation, which helps control gene expression in a dynamic manner.
In an FFL, feedback can either increase (amplify) or decrease (attenuate) the gene expression signal.
Consider a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score greater than a threshold value, we assign an edge between the two in the graph. Given this, which of the following is true:
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete graph
There will be two connected components in the resultant graph
Correct answers
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete graph
Which of the following does not makes an appropriate pair?
Node classification – Predicting drug-drug interaction
Graph classification – Predicting toxicity of a chemical compound
Link Prediction – Predicting function of novel proteins
Graph regression – Predicting free energy of hydration
Correct answers
Node classification – Predicting drug-drug interaction
Link Prediction – Predicting function of novel proteins
How many solutions are possible for a string reconstruction problem with 13 words?
Correct answer
What is the number of 5-mers generated from the sequence : “AGATATATTATTGTCTTTTTTGTCA”?
20
22
15
21
Correct answer
21
What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained from “TACTCTAAG”?
3
5
7
4
Correct answer
7
Given the two sequences “GATTACA”, “GTCGACGCA”, and the scoring paradigm: matches: “+1”, mismatches: “-1” and gap: “-2”, find the final score for the best global alignment between the two sequences.
10
-11
-3
2
Correct answer
-3
Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruct the sequence from which the k-mers were generated.
CTATACCGTAGGCG
CTATGCCGTAGGCG
ATCGGTACAACGG
TATGCCGTAGGCGC
Correct answer
CTATGCCGTAGGCG
