Quiz Space

Big Data and Biological Networks · Quiz 2 · 16 Mar 2025 · January 2025 term

Question 21: Given the two sequences “GATTACA”, “GTCGACGCA”, and the …

Question 21

+3 marksOne correct option

Given the two sequences “GATTACA”, “GTCGACGCA”, and the scoring paradigm: matches: “+1”, mismatches: “-1” and gap: “-2”, find the final score for the best global alignment between the two sequences.

  1. A

    10

  2. B

    -11

  3. C

    -3

  4. D

    2

Show answer

Correct answer

  • C

    -3

Question 21 of 22 in the IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 16 Mar 2025, in the January 2025 term (IIT M DEGREE AN EXAM QDB2 16 Mar 2025). It carries 3 marks.

More questions from this paper

  1. Q1What happens to scale-free networks when subjected to random node removal?
  2. Q2Consider a regular lattice with n = 7 and m = 14. The number of triangular sub-graphs in the given network is
  3. Q3Consider the following set of metabolic reactions:\ R1: P + Q → 2R\ R2: 2Q + S → T\ R3: R + T → 3U\ R4: P + U → V + S\ …
  4. Q4If a metabolite with high betweenness centrality is knocked out, what is the likely consequence?
  5. Q5What is the average degree (regardless of the direction) of the 3-mer De-Bruijn graph constructed from “TCAGAGGT”?
  6. Q6What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATCGGTACAACTCTCTCATGC…
  7. Q7A researcher is studying network motifs in a biological network and generates randomized networks for comparison. Which…
  8. Q8The Girvan–Newman algorithm for community detection involves which of the following steps?
  9. Q9A researcher is modeling the spread of an infectious disease on a small-world network. Which of the following are true …
  10. Q10Which of these are challenges one might encounter in the process of genome assembly?
  11. Q11Consider the following two statements:\ a. Statement 1: Reads from the genome sequencing are prone to error.\ b. Statem…
  12. Q12Microbe ‘M’ has 50 reactions that are stuck when grown by itself. When ‘M’ is grown with ‘N’, the stuck reactions reduc…
  13. Q13Figure question
  14. Q14How are network motifs related to the organization of gene regulatory networks?
  15. Q15Which of the following are true about feed-forward loop (FFL) motifs in transcriptional regulatory networks?
  16. Q16Consider a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score gr…
  17. Q17Which of the following does not makes an appropriate pair?
  18. Q18How many solutions are possible for a string reconstruction problem with 13 words?
  19. Q19What is the number of 5-mers generated from the sequence : “AGATATATTATTGTCTTTTTTGTCA”?
  20. Q20What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained from “TACTCTAAG”?
  21. Q22Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruc…