Question 18
How many solutions are possible for a string reconstruction problem with 13 words?
Question 18: How many solutions are possible for a string reconstruct…
Show answer
Correct answer
Question 18 of 22 in the IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 16 Mar 2025, in the January 2025 term (IIT M DEGREE AN EXAM QDB2 16 Mar 2025). It carries 1 mark.
More questions from this paper
- What happens to scale-free networks when subjected to random node removal?
- Consider a regular lattice with n = 7 and m = 14. The number of triangular sub-graphs in the given network is
- Consider the following set of metabolic reactions:\ R1: P + Q → 2R\ R2: 2Q + S → T\ R3: R + T → 3U\ R4: P + U → V + S\ …
- If a metabolite with high betweenness centrality is knocked out, what is the likely consequence?
- What is the average degree (regardless of the direction) of the 3-mer De-Bruijn graph constructed from “TCAGAGGT”?
- What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATCGGTACAACTCTCTCATGC…
- A researcher is studying network motifs in a biological network and generates randomized networks for comparison. Which…
- The Girvan–Newman algorithm for community detection involves which of the following steps?
- A researcher is modeling the spread of an infectious disease on a small-world network. Which of the following are true …
- Which of these are challenges one might encounter in the process of genome assembly?
- Consider the following two statements:\ a. Statement 1: Reads from the genome sequencing are prone to error.\ b. Statem…
- Microbe ‘M’ has 50 reactions that are stuck when grown by itself. When ‘M’ is grown with ‘N’, the stuck reactions reduc…
- Figure question
- How are network motifs related to the organization of gene regulatory networks?
- Which of the following are true about feed-forward loop (FFL) motifs in transcriptional regulatory networks?
- Consider a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score gr…
- Which of the following does not makes an appropriate pair?
- What is the number of 5-mers generated from the sequence : “AGATATATTATTGTCTTTTTTGTCA”?
- What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained from “TACTCTAAG”?
- Given the two sequences “GATTACA”, “GTCGACGCA”, and the scoring paradigm: matches: “+1”, mismatches: “-1” and gap: “-2”…
- Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruc…