Big Data and Biological Networks Quiz 2 24 Mar 2024 — Question 18
Show answer
Correct answers
Question 18 of 21 in the IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term (IIT M DEGREE AN EXAM QDB2 24 Mar 2024). It carries 3 marks.
More questions from this paper
- How many solutions are possible for a string reconstruction problem with 12 words?
- What is the number of 4-mers generated from the sequence :\ “AGATATATTATTGTCTTTTTTGTCA”?
- What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?
- What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCTAAATATCAAG”?
- In a directed protein-protein interaction network, the researchers want to identify protein clusters that interact dens…
- Which of the following statements is true regarding motif identification in networks?
- Consider the gene interaction networks given below for 4 different conditions (2 normal and 2 diseased). Which of the f…
- Investigator X is tasked with identifying the spread of a virus in a city. The team has narrowed down the origin of the…
- Match the following disease spread problems with their solution; G_P is a people graph, G_L is a location graph. Proble…
- What is the total number of nodes of the De-Bruijn Graph generated from the 2-mers obtained from “TACTCTAAG”?
- Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1…
- Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruc…
- We have a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score gre…
- Which of the following makes an appropriate pair?
- Which of these are challenges one might encounter in the process of genome assembly?
- Consider the following two statements:\ Statement 1: Reads from the genome sequencing are prone to error.\ Statement 2:…
- Figure question
- Use the following metabolic network to answer the given questions. What is the dimension of the stoichiometric matrix o…
- Use the following metabolic network to answer the given questions.
- Use the following metabolic network to answer the given questions. What is the stoichiometric matrix of the provided ne…