Quiz Space

Big Data and Biological Networks · Quiz 2 · 24 Mar 2024 · January 2024 term

Question 2: What is the number of 4-mers generated from the sequence …

Question 2

+1 markOne correct option

What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?

  1. A

    20

  2. B

    22

  3. C

    15

  4. D

    21

Show answer

Correct answer

  • B

    22

See the whole paperTake it as a mock test

Question 2 of 21 in the IIT Madras BS Big Data and Biological Networks (Big Data and Biological Networks) Quiz 2 paper sat on 24 Mar 2024, in the January 2024 term (IIT M DEGREE AN EXAM QDB2 24 Mar 2024). It carries 1 mark.

More questions from this paper

  1. Q1How many solutions are possible for a string reconstruction problem with 12 words?
  2. Q3What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “ATGATACT”?
  3. Q4What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “ATGATCTAAATATCAAG”?
  4. Q5In a directed protein-protein interaction network, the researchers want to identify protein clusters that interact dens…
  5. Q6Which of the following statements is true regarding motif identification in networks?
  6. Q7Consider the gene interaction networks given below for 4 different conditions (2 normal and 2 diseased). Which of the f…
  7. Q8Investigator X is tasked with identifying the spread of a virus in a city. The team has narrowed down the origin of the…
  8. Q9Match the following disease spread problems with their solution; G_P is a people graph, G_L is a location graph. Proble…
  9. Q10What is the total number of nodes of the De-Bruijn Graph generated from the 2-mers obtained from “TACTCTAAG”?
  10. Q11Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “+2”, mismatches: “-3” and gap: “-1…
  11. Q12Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’, ’ATGCC’, reconstruc…
  12. Q13We have a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score gre…
  13. Q14Which of the following makes an appropriate pair?
  14. Q15Which of these are challenges one might encounter in the process of genome assembly?
  15. Q16Consider the following two statements:\ Statement 1: Reads from the genome sequencing are prone to error.\ Statement 2:…
  16. Q17Figure question
  17. Q18Figure question
  18. Q19Use the following metabolic network to answer the given questions. What is the dimension of the stoichiometric matrix o…
  19. Q20Use the following metabolic network to answer the given questions.
  20. Q21Use the following metabolic network to answer the given questions. What is the stoichiometric matrix of the provided ne…