uiz Space

May 2025 term · Algorithmic Thinking in Bioinformatics · BSBT4001

Algorithmic Thinking in Bioinformatics End Term: 31 August 2025 (May 2025 term)

The IIT Madras BS Algorithmic Thinking in Bioinformatics (Algorithmic Thinking in Bioinformatics) End Term paper sat on 31 Aug 2025, in the May 2025 term: 16 questions for 53 marks in 180 minutes. Every question is below with its answer. Take it as a timed mock test to be marked, or read it through first.

Questions
16
Marks
53
Duration
180 min
MCQ
5
Numerical
10
MSQ
1

Updated

Official paper: IIT M IMPROVEMENT FN EXAM QIA1 31 Aug 2025 · No negative marking.

Question 1

+5 marksOne correct option

We run the RANDOMIZEDMOTIFSEARCH algorithm on the following set of DNA strings with k=4k = 4.

Dna=TACCTATGTCCGGCGACTAA\mathit{Dna} = \begin{matrix} \text{TACCT} \\ \text{ATGTC} \\ \text{CGGCG} \\ \text{ACTAA} \end{matrix}

During some iteration of the algorithm, the profile matrix on the chosen 4-mers are given below.

PROFILE(Motifs)=A:0.40.20.20.2C:0.20.40.20.2G:0.20.20.40.2T:0.20.20.20.4\text{PROFILE}(\mathit{Motifs}) = \begin{matrix} \text{A:} & 0.4 & 0.2 & 0.2 & 0.2 \\ \text{C:} & 0.2 & 0.4 & 0.2 & 0.2 \\ \text{G:} & 0.2 & 0.2 & 0.4 & 0.2 \\ \text{T:} & 0.2 & 0.2 & 0.2 & 0.4 \end{matrix}

Which of the following can be the set of motifs that are chosen for the next iteration?

  1. A

    TACC, ATGT, CGGC, ACTA

  2. B

    ACCT, TGTC, GGCG, CTAA

  3. C

    TACC, TGTC, GGCG, CTAA

  4. D

    ACCT, ATGT, CGGC, ACTA

Show answer

Correct answer

  • D

    ACCT, ATGT, CGGC, ACTA

Question 2

+5 marksOne correct option

The theoretical spectrum of the peptide "GAS" is

0 57 71 87 128 144 158 215

Given below in Figure 1 is the partially filled table to compute the spectral convolution. Complete the table and determine which among the following masses have the minimum multiplicity.

0577187128144158
0
5757
717114
878716
12812841
14414416
15815814
215215158144128877157

Figure 1: Partially filled Spectral Convolution Table

  1. A

    14

  2. B

    41

  3. C

    57

  4. D

    128

Show answer

Correct answer

  • B

    41

Question 3

+5 marksNumerical answer

Consider the alignment graph based DP table below to find the best global alignment between two strings (represented along the rows and the columns). The DP table shown below has n×mn \times m entries i.e., DP[0,0]DP[0,0] to DP[n,m]DP[n,m], where nn is length of first string and mm is length of second string. DP[i,j]DP[i,j] is the score of best global alignment between the length-ii prefix of the first string and length-jj prefix of the second string.

Fill the DP table given below and answer the following questions accordingly.

GTACA
G
A
C
A
T

Scoring is done as follows:

  • For each match between two symbols: +1+1 point
  • For each mismatch between two symbols: 00 point
  • For each removal of symbol from any one sequence: 00 point

How many entries in the grid consists of the number 3? Enter the answer as a single integer.

Show answer

Correct answer: 4

Question 4

+5 marksNumerical answer
Show answer

Correct answer: 11

Question 5

+5 marksNumerical answer

Imagine an episode of Tom and Jerry, where Jerry uses the cat ('Butch') and the dog ('Spike') and switches their personalities in the lab. Tom was shocked and could not believe that Butch is behaving like a dog. Imagine you are a friend of Tom, and you have to explain him that it is possible to switch personalities by mutating their genes. You find the synteny blocks in the chromosomes of Butch, Tom and Spike as given below.

\begin{aligned} \mathit{Butch} &= {+5}\ {+3}\ {-1}\ {+4}\ {+2} \\ \mathit{Tom} &= {-3}\ {-2}\ {-1}\ {+5}\ {+4} \\ \mathit{Spike} &= {+1}\ {+2}\ {+3}\ {+4}\ {+5} \end{aligned} \tag{1}

Suppose Jerry's machine first runs an algorithm to determine the breakpoint graph and the sequence of transformations and then applies it on the species. Assume the algorithm only uses the minimum number of transformations needed to convert a species into another. Use the breakpoint graph to determine the total number of transformations Jerry needs to mutate Butch into Spike. Enter the answer as a single integer.

Show answer

Correct answer: 4

Question 6

+2 marksNumerical answer

The de Bruijn graph of some linear (i.e., non-circular) genome Dna comprises of 2 nodes (N1 and N2) and 3 edges – two of these edges are directed from N1 to N2 and the remaining edge is directed from N2 to N1. To reconstruct Dna, you are allowed to start only from the node N1. Answer the given subquestions with respect to the same.

If the k-mers represented by both N1 and N2 are fixed, then how many unique genome sequences can be constructed from this de Bruijn graph? Enter the answer as a single integer.

Show answer

Correct answer: 1

Question 7

+3 marksOne or more correct options

The de Bruijn graph of some linear (i.e., non-circular) genome Dna comprises of 2 nodes (N1 and N2) and 3 edges – two of these edges are directed from N1 to N2 and the remaining edge is directed from N2 to N1. To reconstruct Dna, you are allowed to start only from the node N1. Answer the given subquestions with respect to the same.

Suppose you don’t know the 2-mers representing N1 and N2. Then which of the following is/are possible choices for Dna?

Select all that apply.

  1. A

    TATAT

  2. B

    CACAC

  3. C

    ATATA

  4. D

    AGAGG

  5. E

    TGTGG

Show answer

Correct answers

  • A

    TATAT

  • B

    CACAC

  • C

    ATATA

Question 8

+3 marksNumerical answer

Based on the above data, answer the given subquestions.

What is the value of the probability density function at x = 45 under this model? Round the answer to three decimal digits.

Show answer

Correct answer: 0.065 (accepted within ±0.005)

Question 9

+2 marksNumerical answer

Based on the above data, answer the given subquestions.

What is the probability that this data point was generated by the first cluster? Round the answer to three decimal digits.

Show answer

Correct answer: 0.37 (accepted within ±0.01)

Question 10

+2 marksNumerical answer

You are asked to construct a phylogeny on the distance matrix D using the Additive Phylogeny algorithm. At the end of the 5^(th) iteration, you notice the D^(bald) matrix consumes 81 units of memory space. Assume every entry in a matrix requires 1 unit of space. Also assume the count of the iterations starts from 1. Answer the given subquestions with respect to the same.

How many units of space is required to the corresponding D^(trimmed) matrix? Enter the answer as a single integer.

Show answer

Correct answer: 64

Question 11

+2 marksNumerical answer

You are asked to construct a phylogeny on the distance matrix D using the Additive Phylogeny algorithm. At the end of the 5^(th) iteration, you notice the D^(bald) matrix consumes 81 units of memory space. Assume every entry in a matrix requires 1 unit of space. Also assume the count of the iterations starts from 1. Answer the given subquestions with respect to the same.

How many leaves will be there in the final phylogeny constructed at the end of the algorithm? Enter the answer as a single integer.

Show answer

Correct answer: 13

Question 12

+1 markNumerical answer

You are asked to construct a phylogeny on the distance matrix D using the Additive Phylogeny algorithm. At the end of the 5^(th) iteration, you notice the D^(bald) matrix consumes 81 units of memory space. Assume every entry in a matrix requires 1 unit of space. Also assume the count of the iterations starts from 1. Answer the given subquestions with respect to the same.

Given below in Figure 2 is the pseudocode for the UPGMA algorithm.

text
UPGMA(D, n)
Clusters ← n single-element clusters labeled 1, ..., n
construct a graph T with n isolated nodes labeled by single elements 1, ..., n
for every node v in T
AGE(v) ← 0
while there is more than one cluster
find the two closest clusters C_i and C_j (break ties arbitrarily)
merge C_i and C_j into a new cluster C_new with |C_i| + |C_j| elements
add a new node labeled by cluster C_new to T
connect node C_new to C_i and C_j by directed edges
AGE(C) ← D_{C_i,C_j} / 2
remove the rows and columns of D corresponding to C_i and C_j
remove C_i and C_j from Clusters
add a row/column to D for C_new by computing D(C_new, C) for each C in Clusters
add C_new to Clusters
root ← the node in T corresponding to the remaining cluster
for each edge (v, w) in T
length of (v, w) ← AGE(v) − AGE(w)
return T

Figure 2: UPGMA Algorithm

Read the pseudocode carefully and calculate the number of iterations required by the UPGMA algorithm to construct the Ultrametric tree on D? Enter the answer as a single integer.

Show answer

Correct answer: 12

Question 13

+4 marksNumerical answer

Consider the PWM of a transcription factor (TF) as given in the below table.

A1/161/41/41/23/163/8
C9/161/83/1605/161/4
T05/167/161/43/163/16
G3/85/161/81/45/163/16

Table 1: PWM of a transcription factor (TF)

Based on the above data, answer the given subquestions.

How many 6-mers in the sequence ‘ATTCCGGCCAACAG’ have a nonzero probability of binding to the TF according to the PWM given in the table? Enter the answer as a single integer.

Show answer

Correct answer: 3

Question 14

+4 marksOne correct option

Consider the PWM of a transcription factor (TF) as given in the below table.

A1/161/41/41/23/163/8
C9/161/83/1605/161/4
T05/167/161/43/163/16
G3/85/161/81/45/163/16

Table 1: PWM of a transcription factor (TF)

Based on the above data, answer the given subquestions.

Which of the following substrings is most likely to be bound by the TF?

  1. A

    TTCCGG

  2. B

    CCGGCC

  3. C

    ATTCCG

  4. D

    CCAACA

Show answer

Correct answer

  • D

    CCAACA

Question 15

+2 marksOne correct option

There are two coins from which one is randomly chosen and tossed 5 times, and the sequence of heads or tails is recorded. Consider the table below, which contains sample data from the experiment described above.

TrialCoin Chosen (ZZ)Outcomes (XX)Heads CountTails Count
11H H H H H50
21T T T T T05
32H H H H T41
41H H H H H50
51T H H H H41
61T T H H T23

Based on the above data, answer the given subquestions.

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answer

  • A

Question 16

+3 marksOne correct option

There are two coins from which one is randomly chosen and tossed 5 times, and the sequence of heads or tails is recorded. Consider the table below, which contains sample data from the experiment described above.

TrialCoin Chosen (ZZ)Outcomes (XX)Heads CountTails Count
11H H H H H50
21T T T T T05
32H H H H T41
41H H H H H50
51T H H H H41
61T T H H T23

Based on the above data, answer the given subquestions.

(BONUS QUESTION)

Now assume that the coin identity ZZ is hidden from the given table, but the outcomes XX are observed. Two coins have unknown head probabilities θ1\theta_1 and θ2\theta_2. One of the coins is chosen at random with equal probability (P(Z=1)=P(Z=2)=0.5P(Z = 1) = P(Z = 2) = 0.5), and then tossed 5 times.

Suppose the initial parameter guesses are:

θ1(0)=0.4,θ2(0)=0.8.\theta_1^{(0)} = 0.4, \quad \theta_2^{(0)} = 0.8.

Perform one iteration of the EM algorithm:

E-step: Compute the posterior probabilities

ri1=P(Zi=1∣Xi,θ(0)),ri2=1−ri1r_{i1} = P(Z_i = 1 \mid X_i, \theta^{(0)}), \quad r_{i2} = 1 - r_{i1}

for each trial i=1,…,6i = 1, \ldots, 6.

M-step: Use these posterior weights to update

θ1(1)=∑i=16ri1⋅(heads in trial i)∑i=16ri1⋅5,\theta_1^{(1)} = \frac{\sum_{i=1}^{6} r_{i1} \cdot (\text{heads in trial } i)}{\sum_{i=1}^{6} r_{i1} \cdot 5},

θ2(1)=∑i=16ri2⋅(heads in trial i)∑i=16ri2⋅5.\theta_2^{(1)} = \frac{\sum_{i=1}^{6} r_{i2} \cdot (\text{heads in trial } i)}{\sum_{i=1}^{6} r_{i2} \cdot 5}.

Using the updated parameters θ1(1),θ2(1)\theta_1^{(1)}, \theta_2^{(1)}, compute the posterior probability that trial 5 (HTHHHHTHHH) was generated by coin 1:

P(Z5=1∣X5,θ1(1),θ2(1)).P(Z_5 = 1 \mid X_5, \theta_1^{(1)}, \theta_2^{(1)}).

  1. A
  2. B
  3. C
  4. D
Show answer

Correct answer

  • C