Quiz Space

Algorithmic Thinking in Bioinformatics · End Term · 31 Aug 2025 · May 2025 term

Question 1: We run the RANDOMIZEDMOTIFSEARCH algorithm on the followi…

Question 1

+5 marksOne correct option

We run the RANDOMIZEDMOTIFSEARCH algorithm on the following set of DNA strings with k=4k = 4.

Dna=TACCTATGTCCGGCGACTAA\mathit{Dna} = \begin{matrix} \text{TACCT} \\ \text{ATGTC} \\ \text{CGGCG} \\ \text{ACTAA} \end{matrix}

During some iteration of the algorithm, the profile matrix on the chosen 4-mers are given below.

PROFILE(Motifs)=A:0.40.20.20.2C:0.20.40.20.2G:0.20.20.40.2T:0.20.20.20.4\text{PROFILE}(\mathit{Motifs}) = \begin{matrix} \text{A:} & 0.4 & 0.2 & 0.2 & 0.2 \\ \text{C:} & 0.2 & 0.4 & 0.2 & 0.2 \\ \text{G:} & 0.2 & 0.2 & 0.4 & 0.2 \\ \text{T:} & 0.2 & 0.2 & 0.2 & 0.4 \end{matrix}

Which of the following can be the set of motifs that are chosen for the next iteration?

  1. A

    TACC, ATGT, CGGC, ACTA

  2. B

    ACCT, TGTC, GGCG, CTAA

  3. C

    TACC, TGTC, GGCG, CTAA

  4. D

    ACCT, ATGT, CGGC, ACTA

Show answer

Correct answer

  • D

    ACCT, ATGT, CGGC, ACTA

Question 1 of 16 in the IIT Madras BS Algorithmic Thinking in Bioinformatics (Algorithmic Thinking in Bioinformatics) End Term paper sat on 31 Aug 2025, in the May 2025 term (IIT M IMPROVEMENT FN EXAM QIA1 31 Aug 2025). It carries 5 marks.

More questions from this paper

  1. Q2The theoretical spectrum of the peptide "GAS" is 0 57 71 87 128 144 158 215 Given below in Figure 1 is the partially fi…
  2. Q3Consider the alignment graph based DP table below to find the best global alignment between two strings (represented al…
  3. Q4Figure question
  4. Q5Imagine an episode of Tom and Jerry, where Jerry uses the cat ('Butch') and the dog ('Spike') and switches their person…
  5. Q6If the k-mers represented by both N1 and N2 are fixed, then how many unique genome sequences can be constructed from th…
  6. Q7Suppose you don’t know the 2-mers representing N1 and N2. Then which of the following is/are possible choices for Dna?
  7. Q8What is the value of the probability density function at x = 45 under this model? Round the answer to three decimal dig…
  8. Q9What is the probability that this data point was generated by the first cluster? Round the answer to three decimal digi…
  9. Q10How many units of space is required to the corresponding D^(trimmed) matrix? Enter the answer as a single integer.
  10. Q11How many leaves will be there in the final phylogeny constructed at the end of the algorithm? Enter the answer as a sin…
  11. Q12Given below in Figure 2 is the pseudocode for the UPGMA algorithm. Figure 2: UPGMA Algorithm Read the pseudocode carefu…
  12. Q13Consider the PWM of a transcription factor (TF) as given in the below table. | A | 1/16 | 1/4 | 1/4 | 1/2 | 3/16 | 3/8 …
  13. Q14Consider the PWM of a transcription factor (TF) as given in the below table. | A | 1/16 | 1/4 | 1/4 | 1/2 | 3/16 | 3/8 …
  14. Q15There are two coins from which one is randomly chosen and tossed 5 times, and the sequence of heads or tails is recorde…
  15. Q16There are two coins from which one is randomly chosen and tossed 5 times, and the sequence of heads or tails is recorde…